Data Format:
============
The datasets are provided in CONUS's preferred format,
STOCKHOLM 1.0.  [Technially we are corrupting the STOCKHOLM
format by using it to annotate and represent single 
sequences instead of the multiple sequence alignments for
which it was intended.] See XXX for more information on 
the STOCKHOLM format.

Conus uses the style of structure notation with base pairing 
symbols '>' and '<'.  [For a particular pair the symbols point
to each other.]

----

Example:

# STOCKHOLM 1.0
#=GS DA252 DE DA2521 trna

DA252		GGGGGUAUAGCUCAGUUGGUAGAGCGCUGCCUUUGCAAGGCAGAUGUCAG
#=GR DA252 SS	>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>

DA252		CGGUUCGAGUCCGCUUUAUCUCCA
#=GR DA252 SS	>>>.......<<<<<.<<<<<<<.

//

The Sets:
=========

The sequences in the training set were obtained 
from the European Ribosomal Database in December 2002.  They 
were culled to remove sequences containing more than 5% ambiguous
bases or less than 40% base pairing.  The resulting set was
filtered at 80% identity.  The resulting training set is a 
collection of 278 sequences with equal numbers of LSU and SSU.  

The benchmarking testing set is a collection of 403 sequences 
consisting of 225 RNase P's obtained from Jim Brown's Ribonuclease 
P database, 81 SRP's from Christian Zweib's Signal Recognition 
Particle database, and 97 tmRNA's from Christian Zweib's database.
To obtain this set each family's multiple sequence alignment was
filtered at 80% sequence identity and the structure of each 
remaining sequence was obtained from the parental database.
Sequences containing ambiguous bases were removed.

The ambiguity test set is a collection of 2455 sequences from
174 different families with the Rfam v5 seed alignments.  This
set was built from family alignments which were each filtered 
at 80%.  Sequences containing ambiguous bases were removed.

CONUS data tools:
=================

weedamb  --  takes in a dataset in CONUS preferred format and
	removes any sequence which contains ambiguous bases

scheck	-- the most rudimentary of structure integrity checks

stk2ct	-- converts a CONUS preferred stockholm file into a CT file